AmpliconDesign


DKFZ Logo

AmpliconDesign is a primer design web tool for targeted DNA methylation analysis.

The web tool supports state-of-the-art protocols to design primers for EpiTYPER MassARRAY or targeted Amplicon Bisulfite Sequencing. AmpliconDesign is a all-in-one solution by combining an user-friendly web interface with a fast and efficient data processing workflow.


AmpliconDesign Publication and Benchmarking:
AmpliconDesign – an interactive web server for the design of high-throughput targeted DNA methylation assays
Maximilian Schönung, Jana Hess, Pascal Bawidamann, Sina Stäble, Joschka Hey, Jens Langstein,
Yassen Assenov, Dieter Weichenhan, Pavlo Lutsik, Daniel B. Lipka

Epigenetics, 2020; DOI: 10.1080/15592294.2020.1834921


AmpliconDesign has been developed by:

Section of Translational Cancer Epigenomics,
Division of Translational Medical Oncology, German Cancer Research Center (DKFZ) & National Center for Tumor Diseases (NCT) Heidelberg, Germany
&
Division of Cancer Epigenomics, German Cancer Research Center Heidelberg (DKFZ)


[Translational Cancer Epigenomics](http://www.translational-cancer-epigenomics.de)
[Computational Epigenomics](https://www.dkfz.de/en/CanEpi/CompEpigen/)
[Cancer Epigenomics](https://www.dkfz.de/en/CanEpi/index.php)

Contact:
Maximilian Schönung



DKFZ Logo



AmpliconDesign Visitor Counter:


Home


The MassArray section of AmpliconDesign allows the design and selection of primer pairs for EpiTYPER MassArray. Users need to provide the web service with genome coordinates from common reference genomes. The web service extract DNA sequences from the respective regions, performs bisulfite conversion, genome annotation with common features and determines which CpGs in the respective amplicons can be assayed by MassArray. A graphical output and automated primer design allow a user friendly choice of suitable primers.


The following input parameters can be specified:


Select Genome

Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.

Enter genomic coordinate

Genomic Coordinates of the CpG site of interest can be inserted. NOTE: No comma separation! (Example: chr19:43203328-43203389)



Input Region


Information about the input region will be displayed here.













Genome Annotations


Annotations for the chosen region will be displayed here.





Amplicon Prediction


Amplicon prediction plots will be displayed here.


The following table shows if the CpGs can be assayed by MassArray:

Manual Primer Design


Designed primer pairs will be displayed here.



Suggestions for MassArray Primer Design

The primer melting temperature should be between 52°C and 60°C.
The primer should not overlap with CpGs or SNPs. If unavoidable than place those in the 5' position.
Design primers in a way that the amplicons contain at least 1 CpG and have a size of 100-500 bp (100-200 for FFPE DNA)
After primer design, the forward primer must be preceded at 5’-end by AGGAAGAGAG and the reverse primer at 5’-end by CAGTAATACGACTCACTATAGGGAGAAGCT before ordering

















Automatic Primer Design



Loading...
Loading...


Home


The Amplicon-Bisulfite Sequencing (AmpBS-Seq) section of AmpliconDesign allows the design and selection of primer pairs for targeted DNA methylation analysis by either bisulfite deep amplicon sequencing or pyrosequencing. Users can specify the genomic region of interest either as genome coordinates, Illumina methylation array probe names or FASTA files. Primer design parameters should be specified according to the users requirements and sequening primer handels can be added additionally. Primers will be automatically designed by the web service and users can select certain primer pairs to determine binding sites in the context of genomic regions as a graphical output.


The following input parameters should be specified:


Select Genome

Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.


Select type of input

AmpliconDesign supports CpG-IDs, Genome Coordinates or FASTA files as single or batch input. CpG-IDs or Genome Coordinates have to be slash (’/’) separated for batch input.


Please refere to the help section for a detailed overview of the primer design parameters


Designed Primer


Designed primer pairs will be displayed here.




Used Settings


BisAlign


AmpliconDesign has an automated bisulfite primer blast algorithm which allows users to analyze whether designed primers show mutliple alignment sites in a bisulfite converted genome.

The following input parameters should be specified:


Mode

Users can choose between a single primer alignment (BisAlign) or exploration of potential off-target amplicons resulting from a PCR with the respective forward and reverse primer (ePCR).


Select Genome

Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.


Primer Input

Users can input the primer sequence of interest (primer for bisulfite converted genome only).


Results


BisAlign query results will be displayed here.

Snakemake Pipeline


AmpBS-Seq workflow

Amplicon bisulfite sequencing (AmpBS-Seq) is a powerful approach for targeted DNA methylation analysis. The present protocol describes the detailed workflow, reagents required and offers together with this website all the required ressources for a successfull targeted DNA methylation assay.

Analysis of AmpBS-Seq data

The analysis of AmpBS-Seq data requires several bioinformatic processing steps:

  • Adapter Trimming
  • Alignment
  • Extraction of Methylation Values
  • Quality Control

We have developed a Snakemake Pipeline which integrates several publicly available tools into an off-the-shelf pipeline.

The pipeline provides the user with Bismark coverage (.cov) files which can be further explored using this interactive analysis and quality control pipeline:


Upload Sample Sheet

A sample sheet which specifies meta data and annotations for the analyzed samples can be uploaded. The first column of this file corresponds to the coverage file name (ex. “Sample1.cov”) and a column “UPN” must be included which assigns each sample a unique identifier. An example sample sheet (“meta.txt”) can be downloaded with the sample data.


Upload Regions

The analyzed regions must be uploaded as bed-Files.


Upload .cov Files

Upload of Bismark coverage Files.


Coverage Cut-Off

During the interactive analysis, CpG sites can be filtered based on a minimal number of sequencing reads present at a certain CpG sites.


Download Pipeline Sample Data

Analyzed AmpBS-Seq Results


The AmpBS-Seq analysis results will be displayed here.




Barplot of the total reads per sample (log10 scale):

Barplot showing the number of covered CpG sites per sample:

Correlation between coverage and detected CpG sites:
The number of total reads per sample (log10 scale) is plotted on the x-axis against the number of detected CpG sites (y-axis).

Boxplot showing the number of reads per CpG site (log10 scale):

Barplot showing the number of covered CpG sites per sample after coverage filtering:

Correlation between coverage and detected CpG sites after coverage filtering:
The number of total reads per sample (log10 scale) is plotted on the x-axis against the number of detected CpG sites (y-axis).

Boxplot showing the number of reads per CpG site (log10 scale) after coverage filtering:

Please select which sample annotation column should be used for coloring the samples.
The principal component analysis (PCA) will be computed based on all CpG sites which are covered in all samples:



The heatmap will be computed based on all CpG sites which are covered in all samples:


Heatmap of all CpG sites in the analyzed regions. By applying a coverage cut-off, CpGs with a low coverage might be discarded:

Download AmpBS-Seq Results


The AmpBS-Seq download report will be available here.



Tutorial for MassArray Primer Design


Targeted DNA methylation analysis by MassArray

The MassARRAY® System by Agena Bioscience allows a mass-spectrometry based analysis of DNA methylation patterns with single CpG resolution. The system offers a low-cost alternative and allows users to analyze DNA methylation of even formalin-fixed paraffin-embedded (FFPE) tissue. In short, the procedure begins with a bisulfite conversion of isolated genomic DNA from samples of interest. Thereby, unmethylated cytosines are converted to uracil residues while methylated cytosines are not affected. This ensures a difference in mass which can later on be analyzed by mass-spectrometry. A PCR amplification of the region of interest with a T7-promoter-tagged reverse primer is performed and the resulting fragments are in vitro transcribed. The latter process leads to an incorporation of uracil residues which generates a RNase cleavage pattern in the respective fragments. The fragments can be analyzed by the MassArray MALDI-TOF spectrometer and differ in mass due to the bisulfite treatment.

MassArray Workflow

Source: “http://agenabio.com/wp-content/uploads/2015/06/51-20055R1.0-EpiTYPER-Brochure_WEB.pdf


MassArray primer design

The MassArray primer design process requires several prerequesits compared to normal DNA primer design. First, it has to be assessed whether the analyzed CpGs are located within amplicons which show a mass difference in the MassArray workflow. CpGs which are located in fragments with an overlapping molecular weight (MW) cannot be analyzed as users will not be able to differentiate between CpGs in fragments with a mass-overlap. Second, it has to be determined which strand (Watson or Crick) has more CpG containing fragments which can be analyzed by MassArray. Bisulfite treatment destroys the complementary of both strands so that primers have to be specifically designed for either the coding (Watson) or non-coding (Crick) strand. And third, primers have to be designed for bisulfite converted DNA which requires adjusted primer design parameters.
Considering those prerequesits, MassArray primer design can be considered a tedious process. Users have to extract the genomic DNA sequence for the amplicons of interest, bisulfite convert the conding and non-coding strand in-silico, assess wether CpGs can be detected by MassArray and then design primer pairs. AmpliconDesign offers an all-in-one solution which extracts genomic DNA sequences from common reference genomes, analyzes fragment cleavage patterns, bisulfite converts DNA in-silico and returns a list of suggested primer pairs. Users solely have to provide the genomic coordinates of interest. A graphical output is generated which allows users to select the best primer pairs for MassArray.



Tutorial: Primer Design for MassArray


1.) Select the required genome build

AmpliconDesign currently supports three common genome builds: GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Select the required genome in the drop-down menu.

MassArray Genome

2.) Enter the coordinates of the genomic region of interest

The genomic regions of interest have to be entered in the form of genome coordinates (e.g. chr19:43203328-43203389)
Genomic regions can be further extended within the primer design workflow.
Do neither comma separate the numbers nor add a white space before the coordinates

MassArray Coordinates

3.) Inspect your Input Region

AmpliconDesign extract the region of interest from the reference genome and provides the user with the DNA sequence of the Watson (forward sequence) and Crick strand (reverse complement sequence). Users can furthermore inspect their input region in a tabular format. A slider allows the extension of the input region. The shown DNA sequences provide the user furthermore with information about repeat regions (green), SNP positions (violet) and CpG dinucleotides (red).

MassArray Coordinates

4.) Plot with Genome Annotations

Users can inspect the analyzed genomic region in a plot which includes transcript, SNP, CpG and repeat positions. The page furthermore includes a tabluar output which lists all the CpGs in the analyzed fragment.

MassArray Coordinates

5.) Analyze the in-silico Fragmentation

The amplicon prediction plots have been adapted from the MassArray R package (Thompson RF, Greally JM (2018). MassArray: Analytical Tools for MassArray Data. R package version 1.34.0.). The initial table shows in a binary format which of the covered CpGs can be analyzed by MassArray. The “summary” column inidicates whether a CpG is covered by putative fragments (1 = detectable; 0 = not detectable). The other columns show in which cleavage (C or T cleavage) and on which strand (+ or -) the CpG can be analyzed. It is crucial that users furthermore check the amplicon prediction plots below. Those show the putative fragments and the location of CpGs (filled circle). CpGs within a blue fragment can be uniquely analyzed in the MassArray workflow. Red fragments show overlaping molecular weights (MWs) with another fragment. Grey fragments are outside of the testable mass window. Black fragments do not contain a CpG but are uniquely assayable. Green fragments might contain a conversion control. An overlapping MW between CpG containing fragments is shown by linked arrowheads.

MassArray Coordinates MassArray Coordinates

6.) Manual Primer Design

AmpliconDesign offers the possibility to manually design MassArray primers. Therefore users can select between the Watson and Crick strand, depending on the number of CpGs which are covered. In general it is recommended to select the strand with the highest number of fragments that can be analyzed by MassArray. A selector for the coding strand and one for the non-coding strand allows to mark the putative primer sequence in the genomic region. Please make sure that primer sequences do not overlap with CpGs or SNP (if unavoidable place them in the 5’ position). The first sequence always shows the 5’-3’ direction of the coding strand. So if the Watson strand is selected, this corresponds to the bisulfite converted coding strand. If the Crick strand is selected, this corresponds to the reverse complement of the Crick strand. This visualization is required to ensure the integrity of the genome annotations. The second sequence always shows the 3’-5’ orientation. In case of the Watson selection, the complement of the bisulfite converted coding sequence and in case of the Crick, the bisulfite converted reverse Crick strand (3’-5’).

MassArray Coordinates

The selected primer pair is shown in a table in a ready to order fashion. The table shows the forward primer and reverse primer in the correct orientation. Please ensure to add a T7-promoter tag to the primer of choice before ordering the primers for MassArray. The table furthermore shows primer sizes and the final amplicon size.

MassArray Coordinates

7.) Automated Primer Design

AmpliconDesign furthermore offers the possibility to automatically design primers by calling primer3 (Untergasser et al., NAR, 2012) with bisulfite adjusted parameters. Several input parameters have to be specified to allow a user-specific primer design:

Primer Size

Choose the optimal, minimal and maximal primer size.

Melting Temperature

Choose the optimal, minimal and maximal primer melting temperature.

Amplicon Size

Choose the minimal and maximal amplicon size.

Exclude CG from primer

Recommended: Choose this option to exclude CG dinucleotides from the primer sequence.

Include CpGs in the region

Users can choose if the covered CpGs should be included in the amplicon.



8.) Table with automatically designed primers

AmpliconDesign generates a table with automatically designed primers. This table includes the primer sequence for the plus strand (Amplicon 1) and the minus strand (Amplicon 2). The primer ID is given as the specified input region. Primer sequences for the forward and reverse primer are predicted (whereby t corresponds to bisulfite converted C). The primer begin is given with respect to the amplicon start site, followed by the GC content of the primer, melting temperatures and the total amplicon size. The Region column repeats the input region, and the UCSC coordinates for the forward and reverse primer (left and right) are given, as well as the final amplicon coordinates and the number of CpGs in each amplicon (#CpGs).

MassArray Coordinates

An overview of the putative fragment patterns, including MW, number of covered CpGs and collision (MW overlap with another fragment) are shown for each primer pair when clicking on a row in the primer table. Thereby users can check if their CpG of interest can be analyzed by MassArray.

MassArray Coordinates

9.) Download of the data

AmpliconDesign allows a download of the data and provides the user with all previously specified information, including selected primer sequences and a table with the automatically designed primer pairs.


Interactive Data

Data can be loaded and interactively explored.


Tutorial for AmpBS-Seq Primer Design


Amplicon Bisulfite Sequencing

Amplcion Bisulfite Sequencing (ampBS-Seq) allows a targeted in-depth analysis of genomic regions by next-generation sequencing. It is currently considered as state-of-the-art for DNA methylation biomarker development and is applied in many clinical and academic research laboratories worldwide (Bock et al., Nature Biotechnology, 2016). In short, the workflow starts with the bisulfite conversion of genomic DNA, followed by PCR amplification of the regions of interest. PCR primers must be specifically designed for bisulfite converted DNA and should not contain CpG dinucleotides. The PCR amplicons of each sample are pooled and barcoded which allows the analysis of several sample on one sequencing lane. A bioinformatic analysis can then distinguish between methylated and unmethylated CpGs due to the bisulfite conversion of unmethylated CpG to uracil.

MassArray Workflow

Tutorial: Primer Design for ampBS-Seq


1.) Select the required genome build

AmpliconDesign currently supports three common genome builds: GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Select the required genome in the drop-down menu.

MassArray Genome

2.) Select the input

AmpliconDesign supports CpG-IDs, Genome Coordinates or FASTA files as single or batch input. CpG-IDs or Genome Coordinates have to be slash (’/’) separated for batch input.

FASTA files: FASTA file input accepts standard FATSA files with one or more sequences. The genomic location of the sequence in the fasta file must be specified in the header (Example: >chr19:43203368-43203369)

Genome Coordinate: Genomic Coordinates of the CpG site of interest can be inserted. NOTE: No comma separation! (Example: chr19:43203368-43203369)

CpG ID: The genome assembly hg19 allows the input of CpG-IDs. (Example: cg04882394)

MassArray Genome

3.) Bisulfite Convert

Choose this option to bisulfite convert FASTA files first. For already bisulfite converted sequences: Capital Letter T indicates non-conversion derived thymins and lower case t for bisulfite conversion derived tymins.

MassArray Genome

Warning: Including CpG sites in the primer sequence might introduce a methylation bias in the data and should only be chosen by expert users with great care. When including CpG sites in the primer, the CpG location should be at the 5’ end of the primer sequence as this minimizes the preferential amplification of an unmethylated allel.


4.) Primer Size

Choose the optimal, minimal and maximal primer size.


5.) Melting Temperature

Choose the optimal, minimal and maximal primer melting temperature.


6.) Amplicon Size

Choose the minimal and maximal amplicon size.


7.) Number of Primer to design

Choose how many primers to design per inserted genomic region.


7.) Exclude SNPs from the primer sequence

Common SNPs (hg38: dbSNP 151; hg19: dbSNP 151; mm10: dbSNP 142) can be excluded from the primer sequence to prevent a sample specific amplification bias.


9.) Advanced Setting:

Extend the input genomic region

The selected genomic regions can be extended by the chosen number of base pairs in both directions (not for FASTA).

Add Sequencing Adapter

Add sequencing adapter 5’ of the primer sequence. Adapter sequences can be specified as Adapter Sequence Fwd and Adapter Sequence Rev if this option is selected.

Specify a target region (not for batch input)

For a single genomic region users can specify the position (either genome coordinate or relative base pair position of the amplicon) which should be covered in the amplicon.

MassArray Genome

9.) Overview of used Settings

After submitting the primer design job to the AmpliconDesign web server, users can re-evaluate their chosen settings in the Used Settings section.