AmpliconDesign
AmpliconDesign is a primer design web tool for targeted DNA methylation analysis.
The web tool supports state-of-the-art protocols to design primers for EpiTYPER MassARRAY or targeted Amplicon Bisulfite Sequencing. AmpliconDesign is a all-in-one solution by combining an user-friendly web interface with a fast and efficient data processing workflow.
AmpliconDesign Publication and Benchmarking:
AmpliconDesign – an interactive web server for the design of high-throughput targeted DNA methylation assays
Maximilian Schönung, Jana Hess, Pascal Bawidamann, Sina Stäble, Joschka Hey, Jens Langstein,
Yassen Assenov, Dieter Weichenhan, Pavlo Lutsik, Daniel B. Lipka
Epigenetics, 2020; DOI: 10.1080/15592294.2020.1834921
AmpliconDesign has been developed by:
Section of Translational Cancer Epigenomics,
Division of Translational Medical Oncology, German Cancer Research Center (DKFZ) & National Center for Tumor Diseases (NCT) Heidelberg, Germany
&
Division of Cancer Epigenomics, German Cancer Research Center Heidelberg (DKFZ)
Translational Cancer Epigenomics
Computational Epigenomics
Cancer Epigenomics
Contact:
Maximilian Schönung
AmpliconDesign Visitor Counter:
Home
The MassArray section of AmpliconDesign allows the design and selection of primer pairs for EpiTYPER MassArray. Users need to provide the web service with genome coordinates from common reference genomes. The web service extract DNA sequences from the respective regions, performs bisulfite conversion, genome annotation with common features and determines which CpGs in the respective amplicons can be assayed by MassArray. A graphical output and automated primer design allow a user friendly choice of suitable primers.
The following input parameters can be specified:
Select Genome
Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Enter genomic coordinate
Genomic Coordinates of the CpG site of interest can be inserted. NOTE: No comma separation! (Example: chr19:43203328-43203389)
Input Region
Information about the input region will be displayed here.
Genome Annotations
Annotations for the chosen region will be displayed here.
Amplicon Prediction
Amplicon prediction plots will be displayed here.
The following table shows if the CpGs can be assayed by MassArray:
Manual Primer Design
Designed primer pairs will be displayed here.
Suggestions for MassArray Primer Design
The primer melting temperature should be between 52°C and 60°C.
The primer should not overlap with CpGs or SNPs. If unavoidable than place those in the 5' position.
Design primers in a way that the amplicons contain at least 1 CpG and have a size of 100-500 bp (100-200 for FFPE DNA)
After primer design, the forward primer must be preceded at 5’-end by AGGAAGAGAG and the reverse primer at 5’-end by CAGTAATACGACTCACTATAGGGAGAAGCT before ordering
Automatic Primer Design
Home
The Amplicon-Bisulfite Sequencing (AmpBS-Seq) section of AmpliconDesign allows the design and selection of primer pairs for targeted DNA methylation analysis by either bisulfite deep amplicon sequencing or pyrosequencing. Users can specify the genomic region of interest either as genome coordinates, Illumina methylation array probe names or FASTA files. Primer design parameters should be specified according to the users requirements and sequening primer handels can be added additionally. Primers will be automatically designed by the web service and users can select certain primer pairs to determine binding sites in the context of genomic regions as a graphical output.
The following input parameters should be specified:
Select Genome
Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Select type of input
AmpliconDesign supports CpG-IDs, Genome Coordinates or FASTA files as single or batch input.
CpG-IDs or Genome Coordinates have to be slash ('/') separated for batch input.
Please refere to the help section for a detailed overview of the primer design parameters
Designed Primer
Designed primer pairs will be displayed here.
Used Settings
BisAlign
AmpliconDesign has an automated bisulfite primer blast algorithm which allows users to analyze whether designed primers show mutliple alignment sites in a bisulfite converted genome.
The following input parameters should be specified:
Mode
Users can choose between a single primer alignment (BisAlign) or exploration of potential off-target amplicons resulting from a PCR with the respective forward and reverse primer (ePCR).
Select Genome
Selection of the genome assembly. Users can choose between GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Primer Input
Users can input the primer sequence of interest (primer for bisulfite converted genome only).
Results
BisAlign query results will be displayed here.
Snakemake Pipeline
AmpBS-Seq workflow
Amplicon bisulfite sequencing (AmpBS-Seq) is a powerful approach for targeted DNA methylation analysis. The present protocol describes the detailed workflow, reagents required and offers together with this website all the required ressources for a successfull targeted DNA methylation assay.
Analysis of AmpBS-Seq data
The analysis of AmpBS-Seq data requires several bioinformatic processing steps:
- Adapter Trimming
- Alignment
- Extraction of Methylation Values
- Quality Control
We have developed a Snakemake Pipeline which integrates several publicly available tools into an off-the-shelf pipeline.
The pipeline provides the user with Bismark coverage (.cov) files which can be further explored using this interactive analysis and quality control pipeline:
Upload Sample Sheet
A sample sheet which specifies meta data and annotations for the analyzed samples can be uploaded. The first column of this file corresponds to the coverage file name (ex. “Sample1.cov”) and a column “UPN” must be included which assigns each sample a unique identifier. An example sample sheet (“meta.txt”) can be downloaded with the sample data.
Upload Regions
The analyzed regions must be uploaded as bed-Files.
Upload .cov Files
Upload of Bismark coverage Files.
Coverage Cut-Off
During the interactive analysis, CpG sites can be filtered based on a minimal number of sequencing reads present at a certain CpG sites.
Download Pipeline Sample Data
Analyzed AmpBS-Seq Results
The AmpBS-Seq analysis results will be displayed here.
Barplot showing the number of covered CpG sites per sample:
Correlation between coverage and detected CpG sites:
The number of total reads per sample (log10 scale) is plotted on the x-axis against the number of detected CpG sites (y-axis).
Boxplot showing the number of reads per CpG site (log10 scale):
Correlation between coverage and detected CpG sites after coverage filtering:
The number of total reads per sample (log10 scale) is plotted on the x-axis against the number of detected CpG sites (y-axis).
Boxplot showing the number of reads per CpG site (log10 scale) after coverage filtering:
The heatmap will be computed based on all CpG sites which are covered in all samples:
Heatmap of all CpG sites in the analyzed regions. By applying a coverage cut-off, CpGs with a low coverage might be discarded:
Download AmpBS-Seq Results
The AmpBS-Seq download report will be available here.
Tutorial for MassArray Primer Design
Targeted DNA methylation analysis by MassArray
The MassARRAY® System by Agena Bioscience allows a mass-spectrometry based analysis of DNA methylation patterns with single CpG resolution. The system offers a low-cost alternative and allows users to analyze DNA methylation of even formalin-fixed paraffin-embedded (FFPE) tissue. In short, the procedure begins with a bisulfite conversion of isolated genomic DNA from samples of interest. Thereby, unmethylated cytosines are converted to uracil residues while methylated cytosines are not affected. This ensures a difference in mass which can later on be analyzed by mass-spectrometry. A PCR amplification of the region of interest with a T7-promoter-tagged reverse primer is performed and the resulting fragments are in vitro transcribed. The latter process leads to an incorporation of uracil residues which generates a RNase cleavage pattern in the respective fragments. The fragments can be analyzed by the MassArray MALDI-TOF spectrometer and differ in mass due to the bisulfite treatment.
Source: “http://agenabio.com/wp-content/uploads/2015/06/51-20055R1.0-EpiTYPER-Brochure_WEB.pdf”
MassArray primer design
The MassArray primer design process requires several prerequesits compared to normal DNA primer design. First, it has to be assessed whether the analyzed CpGs are located within
amplicons which show a mass difference in the MassArray workflow. CpGs which are located in fragments with an overlapping molecular weight (MW) cannot be analyzed as users will not be able to differentiate between CpGs in fragments with a mass-overlap. Second, it has to be determined which strand (Watson or Crick) has more CpG containing fragments which can be analyzed by MassArray. Bisulfite treatment destroys the complementary of both strands so that primers have to be specifically designed for either the coding (Watson) or non-coding (Crick) strand. And third, primers have to be designed for bisulfite converted DNA which requires adjusted primer design parameters.
Considering those prerequesits, MassArray primer design can be considered a tedious process. Users have to extract the genomic DNA sequence for the amplicons of interest, bisulfite convert the conding and non-coding strand in-silico, assess wether CpGs can be detected by MassArray and then design primer pairs. AmpliconDesign offers an all-in-one solution which extracts genomic DNA sequences from common reference genomes, analyzes fragment cleavage patterns, bisulfite converts DNA in-silico and returns a list of suggested primer pairs. Users solely have to provide the genomic coordinates of interest. A graphical output is generated which allows users to select the best primer pairs for MassArray.
Tutorial: Primer Design for MassArray
1.) Select the required genome build
AmpliconDesign currently supports three common genome builds: GRCh38/hg38, GRCh27/hg19 and GRCm38/mm10.
Select the required genome in the drop-down menu.